Cheatography
https://cheatography.com
In this lab, we will explore the process of translating an mRNA sequence into its corresponding amino acid sequence. Translation is a fundamental biological process where the information encoded in mRNA is used to build proteins. We will use a genetic code chart (codon table) to decode the mRNA sequence and discover the amino acid sequence it encodes
INTRODUCTION
In this lab, we will delve into the process of deciphering amino acid sequences in polypeptides from a given mRNA nucleotide sequence. The mRNA sequence contains information that directs the synthesis of proteins, and we will use our understanding of the genetic code to convert this information into the corresponding amino acid sequence. |
OBJECTIVES
Comprehend the relationship between mRNA and amino acids.
Learn how to utilize a genetic code chart.
Decode a provided mRNA sequence to determine the amino acid sequence in the resulting polypeptide. |
MATERIALS
mRNA sequence: GCUAUGCCGAAUGUAUUCGGCCAU |
Computer with internet access (for codon table reference) |
Amino acid chart (codon table) |
PROCEDURE
Step 1: mRNA Sequence Analysis |
Examine the given mRNA sequence:
GCUAUGCCGAAUGUAUUCGGCCAU |
Step 2: Identifying Codons |
Divide the mRNA sequence into codons (sets of three nucleotides):
GCU-AUG-CCG-AAU-GUA-UUC-GGC-CAU |
Step 3: Utilizing the Codon Table |
Refer to the codon table to find the corresponding amino acid for each codon. |
Step 4: Translating Codons |
Translate the codons using the codon table to determine the amino acid sequence:
Ala-Met-Pro-Asn-Val-Phe-Gly-His. |
Step 5: Assembling Amino Acid Sequence |
Record the amino acids derived from each codon:
Ala-Met-Pro-Asn-Val-Phe-Gly-His. |
Step 6: Analysis and Conclusion |
Analyze the obtained amino acid sequence to gain insights into the potential protein's properties. |
|
|
RESULTS
Using the mRNA sequence GCUAUGCCGAAUGUAUUCGGCCAU, the translated amino acid sequence is Ala-Met-Pro-Asn-Val-Phe-Gly-His. |
CONCLUSION
In this example, we used the provided mRNA sequence to decode the amino acid sequence. The lab procedure provides a structured approach for students to follow, helping them grasp the concept of translating mRNA into a polypeptide's amino acid sequence. |
|
Created By
Metadata
Comments
No comments yet. Add yours below!
Add a Comment
Related Cheat Sheets
More Cheat Sheets by UmeshJagtap