This is a draft cheat sheet. It is a work in progress and is not finished yet.
BED file format
Column |
e.g. |
Definition |
chrom |
Sc112.1 |
<STR> name of chromosome/scaffold |
start |
2134 |
<INT> start position of feature |
end |
2565 |
<INT> end position of feature |
name |
gene123 |
<STR> name of feature |
score |
544 |
<NUM> score for the feature e.g. bit score |
strand |
+ |
<+/-/.> strand on which feature is located |
thickStart |
2235 |
thickEnd |
2489 |
itemRgb |
255,0,0 |
blockCount |
2 |
blockSizes |
150,80 |
blockStarts |
0,2333 |
GFF vs BED indexing
GFF ┌─1 2 3─┐ 4 ...
G---A---T C ...
BED └─0 1 2 └─3 ...
|
gff > bed:
bed_start = gff_start - 1,
bed_end = gff_end
bed > gff:
gff_start = bed_start + 1,
gff_end = bed_end
|
|
getfasta
$ bedtools getfasta [OPTIONS] -fi <input FASTA> -bed <BED/GFF/VCF>
|
options |
-fo |
Specify an output file name. By default, output goes to stdout. |
-name |
Use the “name” column in the BED file for the FASTA headers in the output FASTA file. |
-tab |
Report extract sequences in a tab-delimited format instead of in FASTA format. |
-bedOut |
Report extract sequences in a tab-delimited BED format instead of in FASTA format. |
-s |
Force strandedness. If the feature occupies the antisense strand, the sequence will be reverse complemented. Default: strand information is ignored. |
-split |
Given BED12 input, extract and concatenate the sequences from the BED “blocks” (e.g., exons) |
maskfasta
$ bedtools maskfasta [OPTIONS] -fi <input FASTA> -bed <BED/GFF/VCF> -fo <output FASTA>
|
OPTIONS |
-soft |
Soft-mask (that is, convert to lower-case bases) the FASTA sequence. By default, hard-masking (that is, conversion to Ns) is performed. |
-mc |
Replace masking character. That is, instead of masking with Ns, use another character. |
FASTA ACTGATCATGATACATGATACCATTAGGATACAATA
BED ████ █████ ████
FASTA' ACTGATNNNNATACATGNNNNNATTAGGNNNNAATA
|
