\documentclass[10pt,a4paper]{article}

% Packages
\usepackage{fancyhdr}           % For header and footer
\usepackage{multicol}           % Allows multicols in tables
\usepackage{tabularx}           % Intelligent column widths
\usepackage{tabulary}           % Used in header and footer
\usepackage{hhline}             % Border under tables
\usepackage{graphicx}           % For images
\usepackage{xcolor}             % For hex colours
%\usepackage[utf8x]{inputenc}    % For unicode character support
\usepackage[T1]{fontenc}        % Without this we get weird character replacements
\usepackage{colortbl}           % For coloured tables
\usepackage{setspace}           % For line height
\usepackage{lastpage}           % Needed for total page number
\usepackage{seqsplit}           % Splits long words.
%\usepackage{opensans}          % Can't make this work so far. Shame. Would be lovely.
\usepackage[normalem]{ulem}     % For underlining links
% Most of the following are not required for the majority
% of cheat sheets but are needed for some symbol support.
\usepackage{amsmath}            % Symbols
\usepackage{MnSymbol}           % Symbols
\usepackage{wasysym}            % Symbols
%\usepackage[english,german,french,spanish,italian]{babel}              % Languages

% Document Info
\author{UmeshJagtap}
\pdfinfo{
  /Title (deciphering-amino-acid-sequence-from-mrna.pdf)
  /Creator (Cheatography)
  /Author (UmeshJagtap)
  /Subject (Deciphering Amino Acid Sequence from mRNA Cheat Sheet)
}

% Lengths and widths
\addtolength{\textwidth}{6cm}
\addtolength{\textheight}{-1cm}
\addtolength{\hoffset}{-3cm}
\addtolength{\voffset}{-2cm}
\setlength{\tabcolsep}{0.2cm} % Space between columns
\setlength{\headsep}{-12pt} % Reduce space between header and content
\setlength{\headheight}{85pt} % If less, LaTeX automatically increases it
\renewcommand{\footrulewidth}{0pt} % Remove footer line
\renewcommand{\headrulewidth}{0pt} % Remove header line
\renewcommand{\seqinsert}{\ifmmode\allowbreak\else\-\fi} % Hyphens in seqsplit
% This two commands together give roughly
% the right line height in the tables
\renewcommand{\arraystretch}{1.3}
\onehalfspacing

% Commands
\newcommand{\SetRowColor}[1]{\noalign{\gdef\RowColorName{#1}}\rowcolor{\RowColorName}} % Shortcut for row colour
\newcommand{\mymulticolumn}[3]{\multicolumn{#1}{>{\columncolor{\RowColorName}}#2}{#3}} % For coloured multi-cols
\newcolumntype{x}[1]{>{\raggedright}p{#1}} % New column types for ragged-right paragraph columns
\newcommand{\tn}{\tabularnewline} % Required as custom column type in use

% Font and Colours
\definecolor{HeadBackground}{HTML}{333333}
\definecolor{FootBackground}{HTML}{666666}
\definecolor{TextColor}{HTML}{333333}
\definecolor{DarkBackground}{HTML}{F03224}
\definecolor{LightBackground}{HTML}{FEF2F1}
\renewcommand{\familydefault}{\sfdefault}
\color{TextColor}

% Header and Footer
\pagestyle{fancy}
\fancyhead{} % Set header to blank
\fancyfoot{} % Set footer to blank
\fancyhead[L]{
\noindent
\begin{multicols}{3}
\begin{tabulary}{5.8cm}{C}
    \SetRowColor{DarkBackground}
    \vspace{-7pt}
    {\parbox{\dimexpr\textwidth-2\fboxsep\relax}{\noindent
        \hspace*{-6pt}\includegraphics[width=5.8cm]{/web/www.cheatography.com/public/images/cheatography_logo.pdf}}
    }
\end{tabulary}
\columnbreak
\begin{tabulary}{11cm}{L}
    \vspace{-2pt}\large{\bf{\textcolor{DarkBackground}{\textrm{Deciphering Amino Acid Sequence from mRNA Cheat Sheet}}}} \\
    \normalsize{by \textcolor{DarkBackground}{UmeshJagtap} via \textcolor{DarkBackground}{\uline{cheatography.com/186232/cs/39855/}}}
\end{tabulary}
\end{multicols}}

\fancyfoot[L]{ \footnotesize
\noindent
\begin{multicols}{3}
\begin{tabulary}{5.8cm}{LL}
  \SetRowColor{FootBackground}
  \mymulticolumn{2}{p{5.377cm}}{\bf\textcolor{white}{Cheatographer}}  \\
  \vspace{-2pt}UmeshJagtap \\
  \uline{cheatography.com/umeshjagtap} \\
  \end{tabulary}
\vfill
\columnbreak
\begin{tabulary}{5.8cm}{L}
  \SetRowColor{FootBackground}
  \mymulticolumn{1}{p{5.377cm}}{\bf\textcolor{white}{Cheat Sheet}}  \\
   \vspace{-2pt}Published 19th August, 2023.\\
   Updated 19th August, 2023.\\
   Page {\thepage} of \pageref{LastPage}.
\end{tabulary}
\vfill
\columnbreak
\begin{tabulary}{5.8cm}{L}
  \SetRowColor{FootBackground}
  \mymulticolumn{1}{p{5.377cm}}{\bf\textcolor{white}{Sponsor}}  \\
  \SetRowColor{white}
  \vspace{-5pt}
  %\includegraphics[width=48px,height=48px]{dave.jpeg}
  Measure your website readability!\\
  www.readability-score.com
\end{tabulary}
\end{multicols}}




\begin{document}
\raggedright
\raggedcolumns

% Set font size to small. Switch to any value
% from this page to resize cheat sheet text:
% www.emerson.emory.edu/services/latex/latex_169.html
\footnotesize % Small font.

\begin{multicols*}{2}

\begin{tabularx}{8.4cm}{X}
\SetRowColor{DarkBackground}
\mymulticolumn{1}{x{8.4cm}}{\bf\textcolor{white}{INTRODUCTION}}  \tn
\SetRowColor{white}
\mymulticolumn{1}{x{8.4cm}}{In this lab, we will delve into the process of deciphering amino acid sequences in polypeptides from a given mRNA nucleotide sequence. The mRNA sequence contains information that directs the synthesis of proteins, and we will use our understanding of the genetic code to convert this information into the corresponding amino acid sequence.% Row Count 7 (+ 7)
} \tn 
\hhline{>{\arrayrulecolor{DarkBackground}}-}
\end{tabularx}
\par\addvspace{1.3em}

\begin{tabularx}{8.4cm}{X}
\SetRowColor{DarkBackground}
\mymulticolumn{1}{x{8.4cm}}{\bf\textcolor{white}{OBJECTIVES}}  \tn
\SetRowColor{white}
\mymulticolumn{1}{x{8.4cm}}{\{\{fa-square-o\}\}Comprehend the relationship between mRNA and amino acids. \newline % Row Count 2 (+ 2)
\{\{fa-square-o\}\}Learn how to utilize a genetic code chart. \newline % Row Count 4 (+ 2)
\{\{fa-square-o\}\}Decode a provided mRNA sequence to determine the amino acid sequence in the resulting polypeptide.% Row Count 7 (+ 3)
} \tn 
\hhline{>{\arrayrulecolor{DarkBackground}}-}
\end{tabularx}
\par\addvspace{1.3em}

\begin{tabularx}{8.4cm}{X}
\SetRowColor{DarkBackground}
\mymulticolumn{1}{x{8.4cm}}{\bf\textcolor{white}{MATERIALS}}  \tn
% Row 0
\SetRowColor{LightBackground}
\mymulticolumn{1}{x{8.4cm}}{mRNA sequence: GCUAUGCCGAAUGUAUUCGGCCAU} \tn 
% Row Count 1 (+ 1)
% Row 1
\SetRowColor{white}
\mymulticolumn{1}{x{8.4cm}}{Computer with internet access (for codon table reference)} \tn 
% Row Count 3 (+ 2)
% Row 2
\SetRowColor{LightBackground}
\mymulticolumn{1}{x{8.4cm}}{Amino acid chart (codon table)} \tn 
% Row Count 4 (+ 1)
\hhline{>{\arrayrulecolor{DarkBackground}}-}
\end{tabularx}
\par\addvspace{1.3em}

\begin{tabularx}{8.4cm}{x{4 cm} x{4 cm} }
\SetRowColor{DarkBackground}
\mymulticolumn{2}{x{8.4cm}}{\bf\textcolor{white}{PROCEDURE}}  \tn
% Row 0
\SetRowColor{LightBackground}
{\bf{Step 1: mRNA Sequence Analysis}} & Examine the given mRNA sequence: \{\{nl\}\} \seqsplit{GCUAUGCCGAAUGUAUUCGGCCAU} \tn 
% Row Count 4 (+ 4)
% Row 1
\SetRowColor{white}
{\bf{Step 2: Identifying Codons}} & Divide the mRNA sequence into codons (sets of three nucleotides): \{\{nl\}\}GCU-AUG-CCG-AAU-GUA-UUC-GGC-CAU \tn 
% Row Count 10 (+ 6)
% Row 2
\SetRowColor{LightBackground}
{\bf{Step 3: Utilizing the Codon Table}} & Refer to the codon table to find the corresponding amino acid for each codon. \tn 
% Row Count 14 (+ 4)
% Row 3
\SetRowColor{white}
{\bf{Step 4: Translating Codons}} & Translate the codons using the codon table to determine the amino acid sequence: \{\{nl\}\} \seqsplit{Ala-Met-Pro-Asn-Val-Phe-Gly-His}. \tn 
% Row Count 20 (+ 6)
% Row 4
\SetRowColor{LightBackground}
{\bf{Step 5: Assembling Amino Acid Sequence}} & Record the amino acids derived from each codon: \{\{nl\}\} \seqsplit{Ala-Met-Pro-Asn-Val-Phe-Gly-His}. \tn 
% Row Count 25 (+ 5)
% Row 5
\SetRowColor{white}
{\bf{Step 6: Analysis and Conclusion}} & Analyze the obtained amino acid sequence to gain insights into the potential protein's properties. \tn 
% Row Count 30 (+ 5)
\hhline{>{\arrayrulecolor{DarkBackground}}--}
\end{tabularx}
\par\addvspace{1.3em}

\begin{tabularx}{8.4cm}{X}
\SetRowColor{DarkBackground}
\mymulticolumn{1}{x{8.4cm}}{\bf\textcolor{white}{RESULTS}}  \tn
\SetRowColor{white}
\mymulticolumn{1}{x{8.4cm}}{Using the mRNA sequence GCUAUGCCGAAUGUAUUCGGCCAU, the translated amino acid sequence is \seqsplit{Ala-Met-Pro-Asn-Val-Phe-Gly-His}.% Row Count 3 (+ 3)
} \tn 
\hhline{>{\arrayrulecolor{DarkBackground}}-}
\end{tabularx}
\par\addvspace{1.3em}

\begin{tabularx}{8.4cm}{X}
\SetRowColor{DarkBackground}
\mymulticolumn{1}{x{8.4cm}}{\bf\textcolor{white}{CONCLUSION}}  \tn
\SetRowColor{white}
\mymulticolumn{1}{x{8.4cm}}{In this example, we used the provided mRNA sequence to decode the amino acid sequence. The lab procedure provides a structured approach for students to follow, helping them grasp the concept of translating mRNA into a polypeptide's amino acid sequence.% Row Count 6 (+ 6)
} \tn 
\hhline{>{\arrayrulecolor{DarkBackground}}-}
\end{tabularx}
\par\addvspace{1.3em}


% That's all folks
\end{multicols*}

\end{document}