\documentclass[10pt,a4paper]{article}

% Packages
\usepackage{fancyhdr}           % For header and footer
\usepackage{multicol}           % Allows multicols in tables
\usepackage{tabularx}           % Intelligent column widths
\usepackage{tabulary}           % Used in header and footer
\usepackage{hhline}             % Border under tables
\usepackage{graphicx}           % For images
\usepackage{xcolor}             % For hex colours
%\usepackage[utf8x]{inputenc}    % For unicode character support
\usepackage[T1]{fontenc}        % Without this we get weird character replacements
\usepackage{colortbl}           % For coloured tables
\usepackage{setspace}           % For line height
\usepackage{lastpage}           % Needed for total page number
\usepackage{seqsplit}           % Splits long words.
%\usepackage{opensans}          % Can't make this work so far. Shame. Would be lovely.
\usepackage[normalem]{ulem}     % For underlining links
% Most of the following are not required for the majority
% of cheat sheets but are needed for some symbol support.
\usepackage{amsmath}            % Symbols
\usepackage{MnSymbol}           % Symbols
\usepackage{wasysym}            % Symbols
%\usepackage[english,german,french,spanish,italian]{babel}              % Languages

% Document Info
\author{ilevantis}
\pdfinfo{
  /Title (bedtools.pdf)
  /Creator (Cheatography)
  /Author (ilevantis)
  /Subject (Bedtools Cheat Sheet)
}

% Lengths and widths
\addtolength{\textwidth}{6cm}
\addtolength{\textheight}{-1cm}
\addtolength{\hoffset}{-3cm}
\addtolength{\voffset}{-2cm}
\setlength{\tabcolsep}{0.2cm} % Space between columns
\setlength{\headsep}{-12pt} % Reduce space between header and content
\setlength{\headheight}{85pt} % If less, LaTeX automatically increases it
\renewcommand{\footrulewidth}{0pt} % Remove footer line
\renewcommand{\headrulewidth}{0pt} % Remove header line
\renewcommand{\seqinsert}{\ifmmode\allowbreak\else\-\fi} % Hyphens in seqsplit
% This two commands together give roughly
% the right line height in the tables
\renewcommand{\arraystretch}{1.3}
\onehalfspacing

% Commands
\newcommand{\SetRowColor}[1]{\noalign{\gdef\RowColorName{#1}}\rowcolor{\RowColorName}} % Shortcut for row colour
\newcommand{\mymulticolumn}[3]{\multicolumn{#1}{>{\columncolor{\RowColorName}}#2}{#3}} % For coloured multi-cols
\newcolumntype{x}[1]{>{\raggedright}p{#1}} % New column types for ragged-right paragraph columns
\newcommand{\tn}{\tabularnewline} % Required as custom column type in use

% Font and Colours
\definecolor{HeadBackground}{HTML}{333333}
\definecolor{FootBackground}{HTML}{666666}
\definecolor{TextColor}{HTML}{333333}
\definecolor{DarkBackground}{HTML}{78A374}
\definecolor{LightBackground}{HTML}{F6F9F6}
\renewcommand{\familydefault}{\sfdefault}
\color{TextColor}

% Header and Footer
\pagestyle{fancy}
\fancyhead{} % Set header to blank
\fancyfoot{} % Set footer to blank
\fancyhead[L]{
\noindent
\begin{multicols}{3}
\begin{tabulary}{5.8cm}{C}
    \SetRowColor{DarkBackground}
    \vspace{-7pt}
    {\parbox{\dimexpr\textwidth-2\fboxsep\relax}{\noindent
        \hspace*{-6pt}\includegraphics[width=5.8cm]{/web/www.cheatography.com/public/images/cheatography_logo.pdf}}
    }
\end{tabulary}
\columnbreak
\begin{tabulary}{11cm}{L}
    \vspace{-2pt}\large{\bf{\textcolor{DarkBackground}{\textrm{Bedtools Cheat Sheet}}}} \\
    \normalsize{by \textcolor{DarkBackground}{ilevantis} via \textcolor{DarkBackground}{\uline{cheatography.com/59886/cs/15673/}}}
\end{tabulary}
\end{multicols}}

\fancyfoot[L]{ \footnotesize
\noindent
\begin{multicols}{3}
\begin{tabulary}{5.8cm}{LL}
  \SetRowColor{FootBackground}
  \mymulticolumn{2}{p{5.377cm}}{\bf\textcolor{white}{Cheatographer}}  \\
  \vspace{-2pt}ilevantis \\
  \uline{cheatography.com/ilevantis} \\
  \end{tabulary}
\vfill
\columnbreak
\begin{tabulary}{5.8cm}{L}
  \SetRowColor{FootBackground}
  \mymulticolumn{1}{p{5.377cm}}{\bf\textcolor{white}{Cheat Sheet}}  \\
   \vspace{-2pt}Not Yet Published.\\
   Updated 2nd May, 2018.\\
   Page {\thepage} of \pageref{LastPage}.
\end{tabulary}
\vfill
\columnbreak
\begin{tabulary}{5.8cm}{L}
  \SetRowColor{FootBackground}
  \mymulticolumn{1}{p{5.377cm}}{\bf\textcolor{white}{Sponsor}}  \\
  \SetRowColor{white}
  \vspace{-5pt}
  %\includegraphics[width=48px,height=48px]{dave.jpeg}
  Measure your website readability!\\
  www.readability-score.com
\end{tabulary}
\end{multicols}}




\begin{document}
\raggedright
\raggedcolumns

% Set font size to small. Switch to any value
% from this page to resize cheat sheet text:
% www.emerson.emory.edu/services/latex/latex_169.html
\footnotesize % Small font.

\begin{multicols*}{2}

\begin{tabularx}{8.4cm}{x{1.656 cm} x{1.08 cm} x{3.744 cm} p{0.72 cm} }
\SetRowColor{DarkBackground}
\mymulticolumn{4}{x{8.4cm}}{\bf\textcolor{white}{BED file format}}  \tn
% Row 0
\SetRowColor{LightBackground}
{\bf{Column}} & {\bf{{\emph{e.g.}}}} & {\bf{Definition}} &  \tn 
% Row Count 2 (+ 2)
% Row 1
\SetRowColor{white}
{\bf{chrom}} & {\emph{Sc112.1}} & \textless{}STR\textgreater{} name of chromosome/scaffold &  \tn 
% Row Count 4 (+ 2)
% Row 2
\SetRowColor{LightBackground}
{\bf{start}} & {\emph{2134}} & \textless{}INT\textgreater{} start position of feature &  \tn 
% Row Count 6 (+ 2)
% Row 3
\SetRowColor{white}
{\bf{end}} & {\emph{2565}} & \textless{}INT\textgreater{} end position of feature &  \tn 
% Row Count 8 (+ 2)
% Row 4
\SetRowColor{LightBackground}
{\bf{name}} & {\emph{gene123}} & \textless{}STR\textgreater{} name of feature &  \tn 
% Row Count 10 (+ 2)
% Row 5
\SetRowColor{white}
{\bf{score}} & {\emph{544}} & \textless{}NUM\textgreater{} score for the feature e.g. bit score &  \tn 
% Row Count 13 (+ 3)
% Row 6
\SetRowColor{LightBackground}
{\bf{strand}} & {\emph{+}} & \textless{}+/-/.\textgreater{} strand on which feature is located &  \tn 
% Row Count 16 (+ 3)
% Row 7
\SetRowColor{white}
{\bf{thickStart}} & {\emph{2235}} &  &  \tn 
% Row Count 18 (+ 2)
% Row 8
\SetRowColor{LightBackground}
{\bf{thickEnd}} & {\emph{2489}} &  &  \tn 
% Row Count 20 (+ 2)
% Row 9
\SetRowColor{white}
{\bf{itemRgb}} & {\emph{255,0,0}} &  &  \tn 
% Row Count 22 (+ 2)
% Row 10
\SetRowColor{LightBackground}
{\bf{blockCount}} & {\emph{2}} &  &  \tn 
% Row Count 24 (+ 2)
% Row 11
\SetRowColor{white}
{\bf{blockSizes}} & {\emph{150,80}} &  &  \tn 
% Row Count 26 (+ 2)
% Row 12
\SetRowColor{LightBackground}
{\bf{blockStarts}} & {\emph{0,2333}} &  &  \tn 
% Row Count 28 (+ 2)
\hhline{>{\arrayrulecolor{DarkBackground}}----}
\end{tabularx}
\par\addvspace{1.3em}

\begin{tabularx}{8.4cm}{X}
\SetRowColor{DarkBackground}
\mymulticolumn{1}{x{8.4cm}}{\bf\textcolor{white}{GFF vs BED indexing}}  \tn
\SetRowColor{LightBackground}
\mymulticolumn{1}{x{8.4cm}}{\seqsplit{GFF~~~~┌─1~~~2~~~3─┐~4~~~}... \newline ~~~~~~~~~G-{}-{}-A-{}-{}-T~~~C~~~... \newline BED~~~~└─0~~~1~~~2~└─3~~~...} \tn 
\hhline{>{\arrayrulecolor{DarkBackground}}-}
\SetRowColor{LightBackground}
\mymulticolumn{1}{x{8.4cm}}{{\bf{gff \textgreater{} bed:}}\{\{nl\}\}bed\_start = gff\_start - 1,\{\{nl\}\}bed\_end = gff\_end \newline {\bf{bed \textgreater{} gff:}}\{\{nl\}\}gff\_start = bed\_start + 1,\{\{nl\}\}gff\_end = bed\_end}  \tn 
\hhline{>{\arrayrulecolor{DarkBackground}}-}
\end{tabularx}
\par\addvspace{1.3em}

\begin{tabularx}{8.4cm}{x{2.52 cm} x{3.24 cm} p{0.72 cm} p{0.72 cm} }
\SetRowColor{DarkBackground}
\mymulticolumn{4}{x{8.4cm}}{\bf\textcolor{white}{getfasta}}  \tn
% Row 0
\SetRowColor{LightBackground}
\mymulticolumn{4}{x{8.4cm}}{\{\{bb\}\}{\bf{`\$ bedtools getfasta {[}OPTIONS{]} -fi \textless{}input FASTA\textgreater{} -bed \textless{}BED/GFF/VCF\textgreater{}`}}} \tn 
% Row Count 2 (+ 2)
% Row 1
\SetRowColor{white}
\mymulticolumn{4}{x{8.4cm}}{{\bf{options}}} \tn 
% Row Count 3 (+ 1)
% Row 2
\SetRowColor{LightBackground}
{\bf{-fo}} & Specify an output file name. By default, output goes to stdout. &  &  \tn 
% Row Count 7 (+ 4)
% Row 3
\SetRowColor{white}
{\bf{-name}} & Use the "name" column in the BED file for the FASTA headers in the output FASTA file. &  &  \tn 
% Row Count 12 (+ 5)
% Row 4
\SetRowColor{LightBackground}
{\bf{-tab}} & Report extract sequences in a tab-delimited format instead of in FASTA format. &  &  \tn 
% Row Count 17 (+ 5)
% Row 5
\SetRowColor{white}
\{\{nobreak\}\}{\bf{-bedOut}} & Report extract sequences in a tab-delimited BED format instead of in FASTA format. &  &  \tn 
% Row Count 22 (+ 5)
% Row 6
\SetRowColor{LightBackground}
{\bf{-s}} & Force strandedness. If the feature occupies the antisense strand, the sequence will be reverse complemented. Default: strand information is ignored. &  &  \tn 
% Row Count 31 (+ 9)
\end{tabularx}
\par\addvspace{1.3em}

\vfill
\columnbreak
\begin{tabularx}{8.4cm}{x{2.52 cm} x{3.24 cm} p{0.72 cm} p{0.72 cm} }
\SetRowColor{DarkBackground}
\mymulticolumn{4}{x{8.4cm}}{\bf\textcolor{white}{getfasta (cont)}}  \tn
% Row 7
\SetRowColor{LightBackground}
{\bf{-split}} & Given BED12 input, extract and concatenate the sequences from the BED "blocks" (e.g., exons) &  &  \tn 
% Row Count 6 (+ 6)
\hhline{>{\arrayrulecolor{DarkBackground}}----}
\end{tabularx}
\par\addvspace{1.3em}

\begin{tabularx}{8.4cm}{x{1.296 cm} x{4.464 cm} p{0.72 cm} p{0.72 cm} }
\SetRowColor{DarkBackground}
\mymulticolumn{4}{x{8.4cm}}{\bf\textcolor{white}{maskfasta}}  \tn
% Row 0
\SetRowColor{LightBackground}
\mymulticolumn{4}{x{8.4cm}}{\{\{bb\}\}{\bf{`\$ bedtools maskfasta {[}OPTIONS{]} -fi \textless{}input FASTA\textgreater{} -bed \textless{}BED/GFF/VCF\textgreater{} -fo \textless{}output FASTA\textgreater{}`}}} \tn 
% Row Count 2 (+ 2)
% Row 1
\SetRowColor{white}
\mymulticolumn{4}{x{8.4cm}}{OPTIONS} \tn 
% Row Count 3 (+ 1)
% Row 2
\SetRowColor{LightBackground}
{\bf{-soft}} & Soft-mask (that is, convert to lower-case bases) the FASTA sequence. By default, hard-masking (that is, conversion to Ns) is performed. &  &  \tn 
% Row Count 9 (+ 6)
% Row 3
\SetRowColor{white}
{\bf{-mc}} & Replace masking character. That is, instead of masking with Ns, use another character. &  &  \tn 
% Row Count 13 (+ 4)
\hhline{>{\arrayrulecolor{DarkBackground}}----}
\SetRowColor{LightBackground}
\mymulticolumn{4}{x{8.4cm}}{\seqsplit{`FASTA~~~ACTGATCATGATACATGATACCATTAGGATACAATA`} \newline `BED~~~~~~~~~~~████~~~~~~~█████~~~~~~████~~~~` \newline `FASTA'~~ACTGATNNNNATACATGNNNNNATTAGGNNNNAATA`}  \tn 
\hhline{>{\arrayrulecolor{DarkBackground}}----}
\end{tabularx}
\par\addvspace{1.3em}


% That's all folks
\end{multicols*}

\end{document}